ID: 900898624

View in Genome Browser
Species Human (GRCh38)
Location 1:5501925-5501947
Sequence GTGGTGCAGGCCGTCGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900898624_900898633 11 Left 900898624 1:5501925-5501947 CCCATCACGACGGCCTGCACCAC No data
Right 900898633 1:5501959-5501981 GAATCCAGCTCATGCATGCGGGG No data
900898624_900898631 9 Left 900898624 1:5501925-5501947 CCCATCACGACGGCCTGCACCAC No data
Right 900898631 1:5501957-5501979 CGGAATCCAGCTCATGCATGCGG No data
900898624_900898632 10 Left 900898624 1:5501925-5501947 CCCATCACGACGGCCTGCACCAC No data
Right 900898632 1:5501958-5501980 GGAATCCAGCTCATGCATGCGGG No data
900898624_900898635 15 Left 900898624 1:5501925-5501947 CCCATCACGACGGCCTGCACCAC No data
Right 900898635 1:5501963-5501985 CCAGCTCATGCATGCGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900898624 Original CRISPR GTGGTGCAGGCCGTCGTGAT GGG (reversed) Intergenic
No off target data available for this crispr