ID: 900899071

View in Genome Browser
Species Human (GRCh38)
Location 1:5504564-5504586
Sequence GGGGAGTGATCTCATCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900899062_900899071 30 Left 900899062 1:5504511-5504533 CCACTCAGCCAGCAGCTGAAGCA No data
Right 900899071 1:5504564-5504586 GGGGAGTGATCTCATCCCCCTGG No data
900899063_900899071 22 Left 900899063 1:5504519-5504541 CCAGCAGCTGAAGCAAGCACTCT No data
Right 900899071 1:5504564-5504586 GGGGAGTGATCTCATCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900899071 Original CRISPR GGGGAGTGATCTCATCCCCC TGG Intergenic
No off target data available for this crispr