ID: 900905106

View in Genome Browser
Species Human (GRCh38)
Location 1:5551614-5551636
Sequence TGCCTGCCAGGAGATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900905106_900905114 -7 Left 900905106 1:5551614-5551636 CCACCCTCATCTCCTGGCAGGCA No data
Right 900905114 1:5551630-5551652 GCAGGCAGGGACCCCAAGGGTGG No data
900905106_900905119 15 Left 900905106 1:5551614-5551636 CCACCCTCATCTCCTGGCAGGCA No data
Right 900905119 1:5551652-5551674 GAGGATTACCTTGCTGAAACAGG No data
900905106_900905113 -10 Left 900905106 1:5551614-5551636 CCACCCTCATCTCCTGGCAGGCA No data
Right 900905113 1:5551627-5551649 CTGGCAGGCAGGGACCCCAAGGG No data
900905106_900905115 -4 Left 900905106 1:5551614-5551636 CCACCCTCATCTCCTGGCAGGCA No data
Right 900905115 1:5551633-5551655 GGCAGGGACCCCAAGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900905106 Original CRISPR TGCCTGCCAGGAGATGAGGG TGG (reversed) Intergenic
No off target data available for this crispr