ID: 900906782

View in Genome Browser
Species Human (GRCh38)
Location 1:5564844-5564866
Sequence CTGTAGGAAAAGAGAGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900906782_900906787 22 Left 900906782 1:5564844-5564866 CCAATTTCTCTCTTTTCCTACAG No data
Right 900906787 1:5564889-5564911 ACACTGGGCTCAGAGAGGTTAGG No data
900906782_900906784 6 Left 900906782 1:5564844-5564866 CCAATTTCTCTCTTTTCCTACAG No data
Right 900906784 1:5564873-5564895 AATCACTATTCAGAGAACACTGG No data
900906782_900906786 17 Left 900906782 1:5564844-5564866 CCAATTTCTCTCTTTTCCTACAG No data
Right 900906786 1:5564884-5564906 AGAGAACACTGGGCTCAGAGAGG No data
900906782_900906785 7 Left 900906782 1:5564844-5564866 CCAATTTCTCTCTTTTCCTACAG No data
Right 900906785 1:5564874-5564896 ATCACTATTCAGAGAACACTGGG No data
900906782_900906788 29 Left 900906782 1:5564844-5564866 CCAATTTCTCTCTTTTCCTACAG No data
Right 900906788 1:5564896-5564918 GCTCAGAGAGGTTAGGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900906782 Original CRISPR CTGTAGGAAAAGAGAGAAAT TGG (reversed) Intergenic
No off target data available for this crispr