ID: 900908098

View in Genome Browser
Species Human (GRCh38)
Location 1:5575019-5575041
Sequence CACATGCAAGTGCCCCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900908098_900908099 -8 Left 900908098 1:5575019-5575041 CCAGCTGGGGGCACTTGCATGTG No data
Right 900908099 1:5575034-5575056 TGCATGTGATGCTCTCAGCCTGG No data
900908098_900908101 18 Left 900908098 1:5575019-5575041 CCAGCTGGGGGCACTTGCATGTG No data
Right 900908101 1:5575060-5575082 AGCCTTGCTCAAACAACTACAGG No data
900908098_900908102 19 Left 900908098 1:5575019-5575041 CCAGCTGGGGGCACTTGCATGTG No data
Right 900908102 1:5575061-5575083 GCCTTGCTCAAACAACTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900908098 Original CRISPR CACATGCAAGTGCCCCCAGC TGG (reversed) Intergenic
No off target data available for this crispr