ID: 900911730

View in Genome Browser
Species Human (GRCh38)
Location 1:5601449-5601471
Sequence AGTGCCAGAGCCTTGGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900911730_900911736 14 Left 900911730 1:5601449-5601471 CCTGGAACCAAGGCTCTGGCACT No data
Right 900911736 1:5601486-5601508 GGGATTGATTAAGTGTGTCGTGG No data
900911730_900911738 23 Left 900911730 1:5601449-5601471 CCTGGAACCAAGGCTCTGGCACT No data
Right 900911738 1:5601495-5601517 TAAGTGTGTCGTGGATAAGGAGG No data
900911730_900911733 -7 Left 900911730 1:5601449-5601471 CCTGGAACCAAGGCTCTGGCACT No data
Right 900911733 1:5601465-5601487 TGGCACTCTTCCTGAGGATTCGG No data
900911730_900911737 20 Left 900911730 1:5601449-5601471 CCTGGAACCAAGGCTCTGGCACT No data
Right 900911737 1:5601492-5601514 GATTAAGTGTGTCGTGGATAAGG No data
900911730_900911734 -6 Left 900911730 1:5601449-5601471 CCTGGAACCAAGGCTCTGGCACT No data
Right 900911734 1:5601466-5601488 GGCACTCTTCCTGAGGATTCGGG No data
900911730_900911739 24 Left 900911730 1:5601449-5601471 CCTGGAACCAAGGCTCTGGCACT No data
Right 900911739 1:5601496-5601518 AAGTGTGTCGTGGATAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900911730 Original CRISPR AGTGCCAGAGCCTTGGTTCC AGG (reversed) Intergenic
No off target data available for this crispr