ID: 900911731

View in Genome Browser
Species Human (GRCh38)
Location 1:5601456-5601478
Sequence CAGGAAGAGTGCCAGAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900911731_900911740 24 Left 900911731 1:5601456-5601478 CCAAGGCTCTGGCACTCTTCCTG No data
Right 900911740 1:5601503-5601525 TCGTGGATAAGGAGGGCTGAAGG No data
900911731_900911737 13 Left 900911731 1:5601456-5601478 CCAAGGCTCTGGCACTCTTCCTG No data
Right 900911737 1:5601492-5601514 GATTAAGTGTGTCGTGGATAAGG No data
900911731_900911738 16 Left 900911731 1:5601456-5601478 CCAAGGCTCTGGCACTCTTCCTG No data
Right 900911738 1:5601495-5601517 TAAGTGTGTCGTGGATAAGGAGG No data
900911731_900911736 7 Left 900911731 1:5601456-5601478 CCAAGGCTCTGGCACTCTTCCTG No data
Right 900911736 1:5601486-5601508 GGGATTGATTAAGTGTGTCGTGG No data
900911731_900911739 17 Left 900911731 1:5601456-5601478 CCAAGGCTCTGGCACTCTTCCTG No data
Right 900911739 1:5601496-5601518 AAGTGTGTCGTGGATAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900911731 Original CRISPR CAGGAAGAGTGCCAGAGCCT TGG (reversed) Intergenic
No off target data available for this crispr