ID: 900911735

View in Genome Browser
Species Human (GRCh38)
Location 1:5601475-5601497
Sequence TTAATCAATCCCGAATCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900911735_900911739 -2 Left 900911735 1:5601475-5601497 CCTGAGGATTCGGGATTGATTAA No data
Right 900911739 1:5601496-5601518 AAGTGTGTCGTGGATAAGGAGGG No data
900911735_900911738 -3 Left 900911735 1:5601475-5601497 CCTGAGGATTCGGGATTGATTAA No data
Right 900911738 1:5601495-5601517 TAAGTGTGTCGTGGATAAGGAGG No data
900911735_900911741 15 Left 900911735 1:5601475-5601497 CCTGAGGATTCGGGATTGATTAA No data
Right 900911741 1:5601513-5601535 GGAGGGCTGAAGGTACACTCTGG No data
900911735_900911740 5 Left 900911735 1:5601475-5601497 CCTGAGGATTCGGGATTGATTAA No data
Right 900911740 1:5601503-5601525 TCGTGGATAAGGAGGGCTGAAGG No data
900911735_900911737 -6 Left 900911735 1:5601475-5601497 CCTGAGGATTCGGGATTGATTAA No data
Right 900911737 1:5601492-5601514 GATTAAGTGTGTCGTGGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900911735 Original CRISPR TTAATCAATCCCGAATCCTC AGG (reversed) Intergenic
No off target data available for this crispr