ID: 900911737

View in Genome Browser
Species Human (GRCh38)
Location 1:5601492-5601514
Sequence GATTAAGTGTGTCGTGGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900911735_900911737 -6 Left 900911735 1:5601475-5601497 CCTGAGGATTCGGGATTGATTAA No data
Right 900911737 1:5601492-5601514 GATTAAGTGTGTCGTGGATAAGG No data
900911730_900911737 20 Left 900911730 1:5601449-5601471 CCTGGAACCAAGGCTCTGGCACT No data
Right 900911737 1:5601492-5601514 GATTAAGTGTGTCGTGGATAAGG No data
900911731_900911737 13 Left 900911731 1:5601456-5601478 CCAAGGCTCTGGCACTCTTCCTG No data
Right 900911737 1:5601492-5601514 GATTAAGTGTGTCGTGGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900911737 Original CRISPR GATTAAGTGTGTCGTGGATA AGG Intergenic
No off target data available for this crispr