ID: 900911740

View in Genome Browser
Species Human (GRCh38)
Location 1:5601503-5601525
Sequence TCGTGGATAAGGAGGGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900911735_900911740 5 Left 900911735 1:5601475-5601497 CCTGAGGATTCGGGATTGATTAA No data
Right 900911740 1:5601503-5601525 TCGTGGATAAGGAGGGCTGAAGG No data
900911731_900911740 24 Left 900911731 1:5601456-5601478 CCAAGGCTCTGGCACTCTTCCTG No data
Right 900911740 1:5601503-5601525 TCGTGGATAAGGAGGGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900911740 Original CRISPR TCGTGGATAAGGAGGGCTGA AGG Intergenic
No off target data available for this crispr