ID: 900911741

View in Genome Browser
Species Human (GRCh38)
Location 1:5601513-5601535
Sequence GGAGGGCTGAAGGTACACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900911735_900911741 15 Left 900911735 1:5601475-5601497 CCTGAGGATTCGGGATTGATTAA No data
Right 900911741 1:5601513-5601535 GGAGGGCTGAAGGTACACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900911741 Original CRISPR GGAGGGCTGAAGGTACACTC TGG Intergenic
No off target data available for this crispr