ID: 900915260

View in Genome Browser
Species Human (GRCh38)
Location 1:5633004-5633026
Sequence GAAGCCAAGGTGACACAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900915260_900915268 27 Left 900915260 1:5633004-5633026 CCATCCTGTGTCACCTTGGCTTC No data
Right 900915268 1:5633054-5633076 GCCTCTTAGCACCTACACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900915260 Original CRISPR GAAGCCAAGGTGACACAGGA TGG (reversed) Intergenic
No off target data available for this crispr