ID: 900915268

View in Genome Browser
Species Human (GRCh38)
Location 1:5633054-5633076
Sequence GCCTCTTAGCACCTACACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900915264_900915268 2 Left 900915264 1:5633029-5633051 CCTCCTTCCTGACGCTCCGTGAT No data
Right 900915268 1:5633054-5633076 GCCTCTTAGCACCTACACGAAGG No data
900915262_900915268 14 Left 900915262 1:5633017-5633039 CCTTGGCTTCCTCCTCCTTCCTG No data
Right 900915268 1:5633054-5633076 GCCTCTTAGCACCTACACGAAGG No data
900915265_900915268 -1 Left 900915265 1:5633032-5633054 CCTTCCTGACGCTCCGTGATGTG No data
Right 900915268 1:5633054-5633076 GCCTCTTAGCACCTACACGAAGG No data
900915266_900915268 -5 Left 900915266 1:5633036-5633058 CCTGACGCTCCGTGATGTGCCTC No data
Right 900915268 1:5633054-5633076 GCCTCTTAGCACCTACACGAAGG No data
900915260_900915268 27 Left 900915260 1:5633004-5633026 CCATCCTGTGTCACCTTGGCTTC No data
Right 900915268 1:5633054-5633076 GCCTCTTAGCACCTACACGAAGG No data
900915263_900915268 5 Left 900915263 1:5633026-5633048 CCTCCTCCTTCCTGACGCTCCGT No data
Right 900915268 1:5633054-5633076 GCCTCTTAGCACCTACACGAAGG No data
900915261_900915268 23 Left 900915261 1:5633008-5633030 CCTGTGTCACCTTGGCTTCCTCC No data
Right 900915268 1:5633054-5633076 GCCTCTTAGCACCTACACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900915268 Original CRISPR GCCTCTTAGCACCTACACGA AGG Intergenic
No off target data available for this crispr