ID: 900917873 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:5651092-5651114 |
Sequence | AGTAGCACGGTGCAGTGGTC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
900917866_900917873 | 7 | Left | 900917866 | 1:5651062-5651084 | CCCTGTCACAGGGCAGGGCTATG | No data | ||
Right | 900917873 | 1:5651092-5651114 | AGTAGCACGGTGCAGTGGTCTGG | No data | ||||
900917867_900917873 | 6 | Left | 900917867 | 1:5651063-5651085 | CCTGTCACAGGGCAGGGCTATGG | No data | ||
Right | 900917873 | 1:5651092-5651114 | AGTAGCACGGTGCAGTGGTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
900917873 | Original CRISPR | AGTAGCACGGTGCAGTGGTC TGG | Intergenic | ||
No off target data available for this crispr |