ID: 900917873

View in Genome Browser
Species Human (GRCh38)
Location 1:5651092-5651114
Sequence AGTAGCACGGTGCAGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900917866_900917873 7 Left 900917866 1:5651062-5651084 CCCTGTCACAGGGCAGGGCTATG No data
Right 900917873 1:5651092-5651114 AGTAGCACGGTGCAGTGGTCTGG No data
900917867_900917873 6 Left 900917867 1:5651063-5651085 CCTGTCACAGGGCAGGGCTATGG No data
Right 900917873 1:5651092-5651114 AGTAGCACGGTGCAGTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900917873 Original CRISPR AGTAGCACGGTGCAGTGGTC TGG Intergenic
No off target data available for this crispr