ID: 900918924

View in Genome Browser
Species Human (GRCh38)
Location 1:5658648-5658670
Sequence CCTTGATGTCATAAGCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900918924_900918926 10 Left 900918924 1:5658648-5658670 CCTGGTGGCTTATGACATCAAGG No data
Right 900918926 1:5658681-5658703 CTCTTGCTGCGTCCTTGCCAAGG No data
900918924_900918932 27 Left 900918924 1:5658648-5658670 CCTGGTGGCTTATGACATCAAGG No data
Right 900918932 1:5658698-5658720 CCAAGGTGCAGCTGGGGCCCTGG No data
900918924_900918927 19 Left 900918924 1:5658648-5658670 CCTGGTGGCTTATGACATCAAGG No data
Right 900918927 1:5658690-5658712 CGTCCTTGCCAAGGTGCAGCTGG No data
900918924_900918929 21 Left 900918924 1:5658648-5658670 CCTGGTGGCTTATGACATCAAGG No data
Right 900918929 1:5658692-5658714 TCCTTGCCAAGGTGCAGCTGGGG No data
900918924_900918928 20 Left 900918924 1:5658648-5658670 CCTGGTGGCTTATGACATCAAGG No data
Right 900918928 1:5658691-5658713 GTCCTTGCCAAGGTGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900918924 Original CRISPR CCTTGATGTCATAAGCCACC AGG (reversed) Intergenic
No off target data available for this crispr