ID: 900919986

View in Genome Browser
Species Human (GRCh38)
Location 1:5663934-5663956
Sequence ATGGAGATGGAGACTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900919978_900919986 19 Left 900919978 1:5663892-5663914 CCCACCCAGGGAGCAGACTTGTA No data
Right 900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG No data
900919979_900919986 18 Left 900919979 1:5663893-5663915 CCACCCAGGGAGCAGACTTGTAC No data
Right 900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG No data
900919982_900919986 -4 Left 900919982 1:5663915-5663937 CCACAATGAAATTTCAGACATGG No data
Right 900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG No data
900919981_900919986 14 Left 900919981 1:5663897-5663919 CCAGGGAGCAGACTTGTACCACA No data
Right 900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG No data
900919980_900919986 15 Left 900919980 1:5663896-5663918 CCCAGGGAGCAGACTTGTACCAC No data
Right 900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900919986 Original CRISPR ATGGAGATGGAGACTGAAGA GGG Intergenic
No off target data available for this crispr