ID: 900920503

View in Genome Browser
Species Human (GRCh38)
Location 1:5667441-5667463
Sequence CACTGTGTGCAGGTTGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900920503_900920506 -6 Left 900920503 1:5667441-5667463 CCTTGTGCAACCTGCACACAGTG No data
Right 900920506 1:5667458-5667480 ACAGTGACCTGTATTCCAGAGGG No data
900920503_900920505 -7 Left 900920503 1:5667441-5667463 CCTTGTGCAACCTGCACACAGTG No data
Right 900920505 1:5667457-5667479 CACAGTGACCTGTATTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900920503 Original CRISPR CACTGTGTGCAGGTTGCACA AGG (reversed) Intergenic
No off target data available for this crispr