ID: 900922604

View in Genome Browser
Species Human (GRCh38)
Location 1:5683096-5683118
Sequence GTCACTGCTGCTGCTGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900922604_900922612 25 Left 900922604 1:5683096-5683118 CCTCCATCAGCAGCAGCAGTGAC No data
Right 900922612 1:5683144-5683166 TTGCCCCTTCCTCCCCTTGGAGG No data
900922604_900922611 22 Left 900922604 1:5683096-5683118 CCTCCATCAGCAGCAGCAGTGAC No data
Right 900922611 1:5683141-5683163 TTCTTGCCCCTTCCTCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900922604 Original CRISPR GTCACTGCTGCTGCTGATGG AGG (reversed) Intergenic