ID: 900922605

View in Genome Browser
Species Human (GRCh38)
Location 1:5683099-5683121
Sequence AGCGTCACTGCTGCTGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900922605_900922612 22 Left 900922605 1:5683099-5683121 CCATCAGCAGCAGCAGTGACGCT No data
Right 900922612 1:5683144-5683166 TTGCCCCTTCCTCCCCTTGGAGG No data
900922605_900922611 19 Left 900922605 1:5683099-5683121 CCATCAGCAGCAGCAGTGACGCT No data
Right 900922611 1:5683141-5683163 TTCTTGCCCCTTCCTCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900922605 Original CRISPR AGCGTCACTGCTGCTGCTGA TGG (reversed) Intergenic
No off target data available for this crispr