ID: 900922612

View in Genome Browser
Species Human (GRCh38)
Location 1:5683144-5683166
Sequence TTGCCCCTTCCTCCCCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900922605_900922612 22 Left 900922605 1:5683099-5683121 CCATCAGCAGCAGCAGTGACGCT No data
Right 900922612 1:5683144-5683166 TTGCCCCTTCCTCCCCTTGGAGG No data
900922604_900922612 25 Left 900922604 1:5683096-5683118 CCTCCATCAGCAGCAGCAGTGAC No data
Right 900922612 1:5683144-5683166 TTGCCCCTTCCTCCCCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900922612 Original CRISPR TTGCCCCTTCCTCCCCTTGG AGG Intergenic
No off target data available for this crispr