ID: 900924882

View in Genome Browser
Species Human (GRCh38)
Location 1:5698573-5698595
Sequence CACTCTTTGCTCCCTAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900924880_900924882 -10 Left 900924880 1:5698560-5698582 CCACTGTATTCATCACTCTTTGC No data
Right 900924882 1:5698573-5698595 CACTCTTTGCTCCCTAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900924882 Original CRISPR CACTCTTTGCTCCCTAAGGC TGG Intergenic
No off target data available for this crispr