ID: 900927259

View in Genome Browser
Species Human (GRCh38)
Location 1:5713399-5713421
Sequence GTCACACCCCATGTGACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900927259_900927267 28 Left 900927259 1:5713399-5713421 CCCAGAGTCACATGGGGTGTGAC No data
Right 900927267 1:5713450-5713472 TGGCTGCAGCTGCACAGTGGAGG No data
900927259_900927265 25 Left 900927259 1:5713399-5713421 CCCAGAGTCACATGGGGTGTGAC No data
Right 900927265 1:5713447-5713469 TCCTGGCTGCAGCTGCACAGTGG No data
900927259_900927263 8 Left 900927259 1:5713399-5713421 CCCAGAGTCACATGGGGTGTGAC No data
Right 900927263 1:5713430-5713452 TCGCTTTGCTCCTTGAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900927259 Original CRISPR GTCACACCCCATGTGACTCT GGG (reversed) Intergenic
No off target data available for this crispr