ID: 900928599 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:5721417-5721439 |
| Sequence | GGCAAGGCACAGATGCAGAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 900928599_900928608 | 28 | Left | 900928599 | 1:5721417-5721439 | CCAATCTGCATCTGTGCCTTGCC | No data | ||
| Right | 900928608 | 1:5721468-5721490 | CGGTGTCAACAAATTGCTCCTGG | No data | ||||
| 900928599_900928605 | 8 | Left | 900928599 | 1:5721417-5721439 | CCAATCTGCATCTGTGCCTTGCC | No data | ||
| Right | 900928605 | 1:5721448-5721470 | CACCCAGAGTTGTCTGACTGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 900928599 | Original CRISPR | GGCAAGGCACAGATGCAGAT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||