ID: 900928599

View in Genome Browser
Species Human (GRCh38)
Location 1:5721417-5721439
Sequence GGCAAGGCACAGATGCAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900928599_900928608 28 Left 900928599 1:5721417-5721439 CCAATCTGCATCTGTGCCTTGCC No data
Right 900928608 1:5721468-5721490 CGGTGTCAACAAATTGCTCCTGG No data
900928599_900928605 8 Left 900928599 1:5721417-5721439 CCAATCTGCATCTGTGCCTTGCC No data
Right 900928605 1:5721448-5721470 CACCCAGAGTTGTCTGACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900928599 Original CRISPR GGCAAGGCACAGATGCAGAT TGG (reversed) Intergenic
No off target data available for this crispr