ID: 900933368

View in Genome Browser
Species Human (GRCh38)
Location 1:5750639-5750661
Sequence CAGGGCTCCATGGGGACGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900933368_900933382 18 Left 900933368 1:5750639-5750661 CCCCTCGTCCCCATGGAGCCCTG No data
Right 900933382 1:5750680-5750702 ACTTCCTTCCTTCCTGTGGAGGG No data
900933368_900933383 21 Left 900933368 1:5750639-5750661 CCCCTCGTCCCCATGGAGCCCTG No data
Right 900933383 1:5750683-5750705 TCCTTCCTTCCTGTGGAGGGAGG No data
900933368_900933375 -9 Left 900933368 1:5750639-5750661 CCCCTCGTCCCCATGGAGCCCTG No data
Right 900933375 1:5750653-5750675 GGAGCCCTGTCCTGTGGCTAAGG No data
900933368_900933385 22 Left 900933368 1:5750639-5750661 CCCCTCGTCCCCATGGAGCCCTG No data
Right 900933385 1:5750684-5750706 CCTTCCTTCCTGTGGAGGGAGGG No data
900933368_900933390 30 Left 900933368 1:5750639-5750661 CCCCTCGTCCCCATGGAGCCCTG No data
Right 900933390 1:5750692-5750714 CCTGTGGAGGGAGGGGGCTGTGG No data
900933368_900933381 17 Left 900933368 1:5750639-5750661 CCCCTCGTCCCCATGGAGCCCTG No data
Right 900933381 1:5750679-5750701 CACTTCCTTCCTTCCTGTGGAGG No data
900933368_900933386 23 Left 900933368 1:5750639-5750661 CCCCTCGTCCCCATGGAGCCCTG No data
Right 900933386 1:5750685-5750707 CTTCCTTCCTGTGGAGGGAGGGG No data
900933368_900933376 -6 Left 900933368 1:5750639-5750661 CCCCTCGTCCCCATGGAGCCCTG No data
Right 900933376 1:5750656-5750678 GCCCTGTCCTGTGGCTAAGGCGG No data
900933368_900933380 14 Left 900933368 1:5750639-5750661 CCCCTCGTCCCCATGGAGCCCTG No data
Right 900933380 1:5750676-5750698 CGGCACTTCCTTCCTTCCTGTGG No data
900933368_900933387 24 Left 900933368 1:5750639-5750661 CCCCTCGTCCCCATGGAGCCCTG No data
Right 900933387 1:5750686-5750708 TTCCTTCCTGTGGAGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900933368 Original CRISPR CAGGGCTCCATGGGGACGAG GGG (reversed) Intergenic
No off target data available for this crispr