ID: 900933495

View in Genome Browser
Species Human (GRCh38)
Location 1:5751130-5751152
Sequence GAAGGGCTTTCTGAGGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900933495_900933502 -3 Left 900933495 1:5751130-5751152 CCTGTAACCTCAGAAAGCCCTTC No data
Right 900933502 1:5751150-5751172 TTCTTTCACAGATTGAGGGAGGG No data
900933495_900933503 0 Left 900933495 1:5751130-5751152 CCTGTAACCTCAGAAAGCCCTTC No data
Right 900933503 1:5751153-5751175 TTTCACAGATTGAGGGAGGGAGG No data
900933495_900933506 10 Left 900933495 1:5751130-5751152 CCTGTAACCTCAGAAAGCCCTTC No data
Right 900933506 1:5751163-5751185 TGAGGGAGGGAGGGGCTCAGAGG No data
900933495_900933498 -7 Left 900933495 1:5751130-5751152 CCTGTAACCTCAGAAAGCCCTTC No data
Right 900933498 1:5751146-5751168 GCCCTTCTTTCACAGATTGAGGG No data
900933495_900933505 2 Left 900933495 1:5751130-5751152 CCTGTAACCTCAGAAAGCCCTTC No data
Right 900933505 1:5751155-5751177 TCACAGATTGAGGGAGGGAGGGG No data
900933495_900933501 -4 Left 900933495 1:5751130-5751152 CCTGTAACCTCAGAAAGCCCTTC No data
Right 900933501 1:5751149-5751171 CTTCTTTCACAGATTGAGGGAGG No data
900933495_900933497 -8 Left 900933495 1:5751130-5751152 CCTGTAACCTCAGAAAGCCCTTC No data
Right 900933497 1:5751145-5751167 AGCCCTTCTTTCACAGATTGAGG No data
900933495_900933504 1 Left 900933495 1:5751130-5751152 CCTGTAACCTCAGAAAGCCCTTC No data
Right 900933504 1:5751154-5751176 TTCACAGATTGAGGGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900933495 Original CRISPR GAAGGGCTTTCTGAGGTTAC AGG (reversed) Intergenic
No off target data available for this crispr