ID: 900933501

View in Genome Browser
Species Human (GRCh38)
Location 1:5751149-5751171
Sequence CTTCTTTCACAGATTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900933495_900933501 -4 Left 900933495 1:5751130-5751152 CCTGTAACCTCAGAAAGCCCTTC No data
Right 900933501 1:5751149-5751171 CTTCTTTCACAGATTGAGGGAGG No data
900933493_900933501 -2 Left 900933493 1:5751128-5751150 CCCCTGTAACCTCAGAAAGCCCT No data
Right 900933501 1:5751149-5751171 CTTCTTTCACAGATTGAGGGAGG No data
900933494_900933501 -3 Left 900933494 1:5751129-5751151 CCCTGTAACCTCAGAAAGCCCTT No data
Right 900933501 1:5751149-5751171 CTTCTTTCACAGATTGAGGGAGG No data
900933492_900933501 8 Left 900933492 1:5751118-5751140 CCTGCATCTTCCCCTGTAACCTC No data
Right 900933501 1:5751149-5751171 CTTCTTTCACAGATTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900933501 Original CRISPR CTTCTTTCACAGATTGAGGG AGG Intergenic
No off target data available for this crispr