ID: 900935691

View in Genome Browser
Species Human (GRCh38)
Location 1:5765078-5765100
Sequence ACGAAGGGCTCTCACCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900935691_900935699 2 Left 900935691 1:5765078-5765100 CCCTGGGGGTGAGAGCCCTTCGT No data
Right 900935699 1:5765103-5765125 TGGGGCCATCTCATGTGCTGTGG No data
900935691_900935700 3 Left 900935691 1:5765078-5765100 CCCTGGGGGTGAGAGCCCTTCGT No data
Right 900935700 1:5765104-5765126 GGGGCCATCTCATGTGCTGTGGG No data
900935691_900935702 7 Left 900935691 1:5765078-5765100 CCCTGGGGGTGAGAGCCCTTCGT No data
Right 900935702 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
900935691_900935704 23 Left 900935691 1:5765078-5765100 CCCTGGGGGTGAGAGCCCTTCGT No data
Right 900935704 1:5765124-5765146 GGGATGGTTCCCCGCACCCTGGG No data
900935691_900935703 22 Left 900935691 1:5765078-5765100 CCCTGGGGGTGAGAGCCCTTCGT No data
Right 900935703 1:5765123-5765145 TGGGATGGTTCCCCGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900935691 Original CRISPR ACGAAGGGCTCTCACCCCCA GGG (reversed) Intergenic