ID: 900935692

View in Genome Browser
Species Human (GRCh38)
Location 1:5765079-5765101
Sequence CACGAAGGGCTCTCACCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900935692_900935700 2 Left 900935692 1:5765079-5765101 CCTGGGGGTGAGAGCCCTTCGTG No data
Right 900935700 1:5765104-5765126 GGGGCCATCTCATGTGCTGTGGG No data
900935692_900935702 6 Left 900935692 1:5765079-5765101 CCTGGGGGTGAGAGCCCTTCGTG No data
Right 900935702 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
900935692_900935704 22 Left 900935692 1:5765079-5765101 CCTGGGGGTGAGAGCCCTTCGTG No data
Right 900935704 1:5765124-5765146 GGGATGGTTCCCCGCACCCTGGG No data
900935692_900935703 21 Left 900935692 1:5765079-5765101 CCTGGGGGTGAGAGCCCTTCGTG No data
Right 900935703 1:5765123-5765145 TGGGATGGTTCCCCGCACCCTGG No data
900935692_900935699 1 Left 900935692 1:5765079-5765101 CCTGGGGGTGAGAGCCCTTCGTG No data
Right 900935699 1:5765103-5765125 TGGGGCCATCTCATGTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900935692 Original CRISPR CACGAAGGGCTCTCACCCCC AGG (reversed) Intergenic