ID: 900935697

View in Genome Browser
Species Human (GRCh38)
Location 1:5765093-5765115
Sequence TGAGATGGCCCCACCACGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900935697_900935702 -8 Left 900935697 1:5765093-5765115 CCCTTCGTGGTGGGGCCATCTCA No data
Right 900935702 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
900935697_900935708 20 Left 900935697 1:5765093-5765115 CCCTTCGTGGTGGGGCCATCTCA No data
Right 900935708 1:5765136-5765158 CGCACCCTGGGCTCCACCCTCGG No data
900935697_900935709 23 Left 900935697 1:5765093-5765115 CCCTTCGTGGTGGGGCCATCTCA No data
Right 900935709 1:5765139-5765161 ACCCTGGGCTCCACCCTCGGAGG No data
900935697_900935704 8 Left 900935697 1:5765093-5765115 CCCTTCGTGGTGGGGCCATCTCA No data
Right 900935704 1:5765124-5765146 GGGATGGTTCCCCGCACCCTGGG No data
900935697_900935703 7 Left 900935697 1:5765093-5765115 CCCTTCGTGGTGGGGCCATCTCA No data
Right 900935703 1:5765123-5765145 TGGGATGGTTCCCCGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900935697 Original CRISPR TGAGATGGCCCCACCACGAA GGG (reversed) Intergenic