ID: 900935698

View in Genome Browser
Species Human (GRCh38)
Location 1:5765094-5765116
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900935698_900935708 19 Left 900935698 1:5765094-5765116 CCTTCGTGGTGGGGCCATCTCAT No data
Right 900935708 1:5765136-5765158 CGCACCCTGGGCTCCACCCTCGG No data
900935698_900935704 7 Left 900935698 1:5765094-5765116 CCTTCGTGGTGGGGCCATCTCAT No data
Right 900935704 1:5765124-5765146 GGGATGGTTCCCCGCACCCTGGG No data
900935698_900935709 22 Left 900935698 1:5765094-5765116 CCTTCGTGGTGGGGCCATCTCAT No data
Right 900935709 1:5765139-5765161 ACCCTGGGCTCCACCCTCGGAGG No data
900935698_900935702 -9 Left 900935698 1:5765094-5765116 CCTTCGTGGTGGGGCCATCTCAT No data
Right 900935702 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
900935698_900935703 6 Left 900935698 1:5765094-5765116 CCTTCGTGGTGGGGCCATCTCAT No data
Right 900935703 1:5765123-5765145 TGGGATGGTTCCCCGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900935698 Original CRISPR ATGAGATGGCCCCACCACGA AGG (reversed) Intergenic