ID: 900935701

View in Genome Browser
Species Human (GRCh38)
Location 1:5765108-5765130
Sequence CCATCCCACAGCACATGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900935701_900935704 -7 Left 900935701 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
Right 900935704 1:5765124-5765146 GGGATGGTTCCCCGCACCCTGGG No data
900935701_900935708 5 Left 900935701 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
Right 900935708 1:5765136-5765158 CGCACCCTGGGCTCCACCCTCGG No data
900935701_900935709 8 Left 900935701 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
Right 900935709 1:5765139-5765161 ACCCTGGGCTCCACCCTCGGAGG No data
900935701_900935703 -8 Left 900935701 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
Right 900935703 1:5765123-5765145 TGGGATGGTTCCCCGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900935701 Original CRISPR CCATCCCACAGCACATGAGA TGG (reversed) Intergenic