ID: 900935702

View in Genome Browser
Species Human (GRCh38)
Location 1:5765108-5765130
Sequence CCATCTCATGTGCTGTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900935697_900935702 -8 Left 900935697 1:5765093-5765115 CCCTTCGTGGTGGGGCCATCTCA No data
Right 900935702 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
900935690_900935702 17 Left 900935690 1:5765068-5765090 CCACTGTGCACCCTGGGGGTGAG No data
Right 900935702 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
900935698_900935702 -9 Left 900935698 1:5765094-5765116 CCTTCGTGGTGGGGCCATCTCAT No data
Right 900935702 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
900935691_900935702 7 Left 900935691 1:5765078-5765100 CCCTGGGGGTGAGAGCCCTTCGT No data
Right 900935702 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
900935692_900935702 6 Left 900935692 1:5765079-5765101 CCTGGGGGTGAGAGCCCTTCGTG No data
Right 900935702 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
900935689_900935702 20 Left 900935689 1:5765065-5765087 CCTCCACTGTGCACCCTGGGGGT No data
Right 900935702 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900935702 Original CRISPR CCATCTCATGTGCTGTGGGA TGG Intergenic