ID: 900935703

View in Genome Browser
Species Human (GRCh38)
Location 1:5765123-5765145
Sequence TGGGATGGTTCCCCGCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900935691_900935703 22 Left 900935691 1:5765078-5765100 CCCTGGGGGTGAGAGCCCTTCGT No data
Right 900935703 1:5765123-5765145 TGGGATGGTTCCCCGCACCCTGG No data
900935697_900935703 7 Left 900935697 1:5765093-5765115 CCCTTCGTGGTGGGGCCATCTCA No data
Right 900935703 1:5765123-5765145 TGGGATGGTTCCCCGCACCCTGG No data
900935692_900935703 21 Left 900935692 1:5765079-5765101 CCTGGGGGTGAGAGCCCTTCGTG No data
Right 900935703 1:5765123-5765145 TGGGATGGTTCCCCGCACCCTGG No data
900935701_900935703 -8 Left 900935701 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
Right 900935703 1:5765123-5765145 TGGGATGGTTCCCCGCACCCTGG No data
900935698_900935703 6 Left 900935698 1:5765094-5765116 CCTTCGTGGTGGGGCCATCTCAT No data
Right 900935703 1:5765123-5765145 TGGGATGGTTCCCCGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900935703 Original CRISPR TGGGATGGTTCCCCGCACCC TGG Intergenic