ID: 900935708

View in Genome Browser
Species Human (GRCh38)
Location 1:5765136-5765158
Sequence CGCACCCTGGGCTCCACCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900935701_900935708 5 Left 900935701 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
Right 900935708 1:5765136-5765158 CGCACCCTGGGCTCCACCCTCGG No data
900935698_900935708 19 Left 900935698 1:5765094-5765116 CCTTCGTGGTGGGGCCATCTCAT No data
Right 900935708 1:5765136-5765158 CGCACCCTGGGCTCCACCCTCGG No data
900935697_900935708 20 Left 900935697 1:5765093-5765115 CCCTTCGTGGTGGGGCCATCTCA No data
Right 900935708 1:5765136-5765158 CGCACCCTGGGCTCCACCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900935708 Original CRISPR CGCACCCTGGGCTCCACCCT CGG Intergenic