ID: 900935709

View in Genome Browser
Species Human (GRCh38)
Location 1:5765139-5765161
Sequence ACCCTGGGCTCCACCCTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900935697_900935709 23 Left 900935697 1:5765093-5765115 CCCTTCGTGGTGGGGCCATCTCA No data
Right 900935709 1:5765139-5765161 ACCCTGGGCTCCACCCTCGGAGG No data
900935701_900935709 8 Left 900935701 1:5765108-5765130 CCATCTCATGTGCTGTGGGATGG No data
Right 900935709 1:5765139-5765161 ACCCTGGGCTCCACCCTCGGAGG No data
900935698_900935709 22 Left 900935698 1:5765094-5765116 CCTTCGTGGTGGGGCCATCTCAT No data
Right 900935709 1:5765139-5765161 ACCCTGGGCTCCACCCTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900935709 Original CRISPR ACCCTGGGCTCCACCCTCGG AGG Intergenic