ID: 900936869

View in Genome Browser
Species Human (GRCh38)
Location 1:5771597-5771619
Sequence ATCTGGCCTCTGTTCCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900936869_900936877 -1 Left 900936869 1:5771597-5771619 CCTGGCTGGAACAGAGGCCAGAT No data
Right 900936877 1:5771619-5771641 TGGCCCGGCATGGGGGCCAGTGG No data
900936869_900936874 -9 Left 900936869 1:5771597-5771619 CCTGGCTGGAACAGAGGCCAGAT No data
Right 900936874 1:5771611-5771633 AGGCCAGATGGCCCGGCATGGGG No data
900936869_900936873 -10 Left 900936869 1:5771597-5771619 CCTGGCTGGAACAGAGGCCAGAT No data
Right 900936873 1:5771610-5771632 GAGGCCAGATGGCCCGGCATGGG No data
900936869_900936882 12 Left 900936869 1:5771597-5771619 CCTGGCTGGAACAGAGGCCAGAT No data
Right 900936882 1:5771632-5771654 GGGCCAGTGGGAACCAGAGGTGG No data
900936869_900936878 0 Left 900936869 1:5771597-5771619 CCTGGCTGGAACAGAGGCCAGAT No data
Right 900936878 1:5771620-5771642 GGCCCGGCATGGGGGCCAGTGGG No data
900936869_900936875 -8 Left 900936869 1:5771597-5771619 CCTGGCTGGAACAGAGGCCAGAT No data
Right 900936875 1:5771612-5771634 GGCCAGATGGCCCGGCATGGGGG No data
900936869_900936881 9 Left 900936869 1:5771597-5771619 CCTGGCTGGAACAGAGGCCAGAT No data
Right 900936881 1:5771629-5771651 TGGGGGCCAGTGGGAACCAGAGG No data
900936869_900936883 13 Left 900936869 1:5771597-5771619 CCTGGCTGGAACAGAGGCCAGAT No data
Right 900936883 1:5771633-5771655 GGCCAGTGGGAACCAGAGGTGGG No data
900936869_900936884 14 Left 900936869 1:5771597-5771619 CCTGGCTGGAACAGAGGCCAGAT No data
Right 900936884 1:5771634-5771656 GCCAGTGGGAACCAGAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900936869 Original CRISPR ATCTGGCCTCTGTTCCAGCC AGG (reversed) Intergenic
No off target data available for this crispr