ID: 900936874

View in Genome Browser
Species Human (GRCh38)
Location 1:5771611-5771633
Sequence AGGCCAGATGGCCCGGCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900936869_900936874 -9 Left 900936869 1:5771597-5771619 CCTGGCTGGAACAGAGGCCAGAT No data
Right 900936874 1:5771611-5771633 AGGCCAGATGGCCCGGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900936874 Original CRISPR AGGCCAGATGGCCCGGCATG GGG Intergenic
No off target data available for this crispr