ID: 900939324

View in Genome Browser
Species Human (GRCh38)
Location 1:5787596-5787618
Sequence GACCCCTAGGTAGTTCGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900939324_900939339 30 Left 900939324 1:5787596-5787618 CCTGTCCGAACTACCTAGGGGTC No data
Right 900939339 1:5787649-5787671 GGGACACACTCTCAGATGAAAGG No data
900939324_900939330 2 Left 900939324 1:5787596-5787618 CCTGTCCGAACTACCTAGGGGTC No data
Right 900939330 1:5787621-5787643 CTCTGGACTGGAATGCCCCCAGG No data
900939324_900939332 8 Left 900939324 1:5787596-5787618 CCTGTCCGAACTACCTAGGGGTC No data
Right 900939332 1:5787627-5787649 ACTGGAATGCCCCCAGGGATTGG No data
900939324_900939334 10 Left 900939324 1:5787596-5787618 CCTGTCCGAACTACCTAGGGGTC No data
Right 900939334 1:5787629-5787651 TGGAATGCCCCCAGGGATTGGGG No data
900939324_900939331 3 Left 900939324 1:5787596-5787618 CCTGTCCGAACTACCTAGGGGTC No data
Right 900939331 1:5787622-5787644 TCTGGACTGGAATGCCCCCAGGG No data
900939324_900939328 -10 Left 900939324 1:5787596-5787618 CCTGTCCGAACTACCTAGGGGTC No data
Right 900939328 1:5787609-5787631 CCTAGGGGTCTCCTCTGGACTGG No data
900939324_900939333 9 Left 900939324 1:5787596-5787618 CCTGTCCGAACTACCTAGGGGTC No data
Right 900939333 1:5787628-5787650 CTGGAATGCCCCCAGGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900939324 Original CRISPR GACCCCTAGGTAGTTCGGAC AGG (reversed) Intergenic
No off target data available for this crispr