ID: 900939325

View in Genome Browser
Species Human (GRCh38)
Location 1:5787601-5787623
Sequence GAGGAGACCCCTAGGTAGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900939325_900939339 25 Left 900939325 1:5787601-5787623 CCGAACTACCTAGGGGTCTCCTC No data
Right 900939339 1:5787649-5787671 GGGACACACTCTCAGATGAAAGG No data
900939325_900939333 4 Left 900939325 1:5787601-5787623 CCGAACTACCTAGGGGTCTCCTC No data
Right 900939333 1:5787628-5787650 CTGGAATGCCCCCAGGGATTGGG No data
900939325_900939332 3 Left 900939325 1:5787601-5787623 CCGAACTACCTAGGGGTCTCCTC No data
Right 900939332 1:5787627-5787649 ACTGGAATGCCCCCAGGGATTGG No data
900939325_900939334 5 Left 900939325 1:5787601-5787623 CCGAACTACCTAGGGGTCTCCTC No data
Right 900939334 1:5787629-5787651 TGGAATGCCCCCAGGGATTGGGG No data
900939325_900939331 -2 Left 900939325 1:5787601-5787623 CCGAACTACCTAGGGGTCTCCTC No data
Right 900939331 1:5787622-5787644 TCTGGACTGGAATGCCCCCAGGG No data
900939325_900939340 30 Left 900939325 1:5787601-5787623 CCGAACTACCTAGGGGTCTCCTC No data
Right 900939340 1:5787654-5787676 ACACTCTCAGATGAAAGGAATGG No data
900939325_900939330 -3 Left 900939325 1:5787601-5787623 CCGAACTACCTAGGGGTCTCCTC No data
Right 900939330 1:5787621-5787643 CTCTGGACTGGAATGCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900939325 Original CRISPR GAGGAGACCCCTAGGTAGTT CGG (reversed) Intergenic
No off target data available for this crispr