ID: 900939330

View in Genome Browser
Species Human (GRCh38)
Location 1:5787621-5787643
Sequence CTCTGGACTGGAATGCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900939325_900939330 -3 Left 900939325 1:5787601-5787623 CCGAACTACCTAGGGGTCTCCTC No data
Right 900939330 1:5787621-5787643 CTCTGGACTGGAATGCCCCCAGG No data
900939324_900939330 2 Left 900939324 1:5787596-5787618 CCTGTCCGAACTACCTAGGGGTC No data
Right 900939330 1:5787621-5787643 CTCTGGACTGGAATGCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900939330 Original CRISPR CTCTGGACTGGAATGCCCCC AGG Intergenic
No off target data available for this crispr