ID: 900940454

View in Genome Browser
Species Human (GRCh38)
Location 1:5795321-5795343
Sequence CAGGCTGACCAGATATTTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900940454_900940461 0 Left 900940454 1:5795321-5795343 CCCGCAAATATCTGGTCAGCCTG No data
Right 900940461 1:5795344-5795366 GTTGGTGACAGCAGCCAAAGGGG No data
900940454_900940460 -1 Left 900940454 1:5795321-5795343 CCCGCAAATATCTGGTCAGCCTG No data
Right 900940460 1:5795343-5795365 GGTTGGTGACAGCAGCCAAAGGG No data
900940454_900940463 16 Left 900940454 1:5795321-5795343 CCCGCAAATATCTGGTCAGCCTG No data
Right 900940463 1:5795360-5795382 AAAGGGGAGCCCCACTTCCAAGG No data
900940454_900940459 -2 Left 900940454 1:5795321-5795343 CCCGCAAATATCTGGTCAGCCTG No data
Right 900940459 1:5795342-5795364 TGGTTGGTGACAGCAGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900940454 Original CRISPR CAGGCTGACCAGATATTTGC GGG (reversed) Intergenic
No off target data available for this crispr