ID: 900940902

View in Genome Browser
Species Human (GRCh38)
Location 1:5798092-5798114
Sequence GCTGATGGGGAGAGAGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900940897_900940902 -9 Left 900940897 1:5798078-5798100 CCACTGGGAGCACAGCTGATGGG No data
Right 900940902 1:5798092-5798114 GCTGATGGGGAGAGAGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900940902 Original CRISPR GCTGATGGGGAGAGAGGAGG TGG Intergenic
No off target data available for this crispr