ID: 900941962

View in Genome Browser
Species Human (GRCh38)
Location 1:5804690-5804712
Sequence TACAAGGACTGGGGTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900941962_900941973 29 Left 900941962 1:5804690-5804712 CCCACAGCACCCCAGTCCTTGTA No data
Right 900941973 1:5804742-5804764 ACCTGCTCTACGTACTTGGGAGG No data
900941962_900941971 25 Left 900941962 1:5804690-5804712 CCCACAGCACCCCAGTCCTTGTA No data
Right 900941971 1:5804738-5804760 ATCAACCTGCTCTACGTACTTGG No data
900941962_900941972 26 Left 900941962 1:5804690-5804712 CCCACAGCACCCCAGTCCTTGTA No data
Right 900941972 1:5804739-5804761 TCAACCTGCTCTACGTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900941962 Original CRISPR TACAAGGACTGGGGTGCTGT GGG (reversed) Intergenic
No off target data available for this crispr