ID: 900941964

View in Genome Browser
Species Human (GRCh38)
Location 1:5804699-5804721
Sequence TGATTCTCTTACAAGGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900941964_900941971 16 Left 900941964 1:5804699-5804721 CCCCAGTCCTTGTAAGAGAATCA No data
Right 900941971 1:5804738-5804760 ATCAACCTGCTCTACGTACTTGG No data
900941964_900941973 20 Left 900941964 1:5804699-5804721 CCCCAGTCCTTGTAAGAGAATCA No data
Right 900941973 1:5804742-5804764 ACCTGCTCTACGTACTTGGGAGG No data
900941964_900941972 17 Left 900941964 1:5804699-5804721 CCCCAGTCCTTGTAAGAGAATCA No data
Right 900941972 1:5804739-5804761 TCAACCTGCTCTACGTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900941964 Original CRISPR TGATTCTCTTACAAGGACTG GGG (reversed) Intergenic
No off target data available for this crispr