ID: 900941965

View in Genome Browser
Species Human (GRCh38)
Location 1:5804700-5804722
Sequence GTGATTCTCTTACAAGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900941965_900941971 15 Left 900941965 1:5804700-5804722 CCCAGTCCTTGTAAGAGAATCAC No data
Right 900941971 1:5804738-5804760 ATCAACCTGCTCTACGTACTTGG No data
900941965_900941973 19 Left 900941965 1:5804700-5804722 CCCAGTCCTTGTAAGAGAATCAC No data
Right 900941973 1:5804742-5804764 ACCTGCTCTACGTACTTGGGAGG No data
900941965_900941972 16 Left 900941965 1:5804700-5804722 CCCAGTCCTTGTAAGAGAATCAC No data
Right 900941972 1:5804739-5804761 TCAACCTGCTCTACGTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900941965 Original CRISPR GTGATTCTCTTACAAGGACT GGG (reversed) Intergenic
No off target data available for this crispr