ID: 900941966

View in Genome Browser
Species Human (GRCh38)
Location 1:5804701-5804723
Sequence GGTGATTCTCTTACAAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900941966_900941971 14 Left 900941966 1:5804701-5804723 CCAGTCCTTGTAAGAGAATCACC No data
Right 900941971 1:5804738-5804760 ATCAACCTGCTCTACGTACTTGG No data
900941966_900941972 15 Left 900941966 1:5804701-5804723 CCAGTCCTTGTAAGAGAATCACC No data
Right 900941972 1:5804739-5804761 TCAACCTGCTCTACGTACTTGGG No data
900941966_900941973 18 Left 900941966 1:5804701-5804723 CCAGTCCTTGTAAGAGAATCACC No data
Right 900941973 1:5804742-5804764 ACCTGCTCTACGTACTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900941966 Original CRISPR GGTGATTCTCTTACAAGGAC TGG (reversed) Intergenic
No off target data available for this crispr