ID: 900941967

View in Genome Browser
Species Human (GRCh38)
Location 1:5804706-5804728
Sequence TTTGGGGTGATTCTCTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900941967_900941972 10 Left 900941967 1:5804706-5804728 CCTTGTAAGAGAATCACCCCAAA No data
Right 900941972 1:5804739-5804761 TCAACCTGCTCTACGTACTTGGG No data
900941967_900941971 9 Left 900941967 1:5804706-5804728 CCTTGTAAGAGAATCACCCCAAA No data
Right 900941971 1:5804738-5804760 ATCAACCTGCTCTACGTACTTGG No data
900941967_900941973 13 Left 900941967 1:5804706-5804728 CCTTGTAAGAGAATCACCCCAAA No data
Right 900941973 1:5804742-5804764 ACCTGCTCTACGTACTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900941967 Original CRISPR TTTGGGGTGATTCTCTTACA AGG (reversed) Intergenic
No off target data available for this crispr