ID: 900941968

View in Genome Browser
Species Human (GRCh38)
Location 1:5804722-5804744
Sequence GGTTGATATGTCTACATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900941968_900941976 22 Left 900941968 1:5804722-5804744 CCCCAAATGTAGACATATCAACC No data
Right 900941976 1:5804767-5804789 AAGCTACAAATGATTCCAGAGGG No data
900941968_900941973 -3 Left 900941968 1:5804722-5804744 CCCCAAATGTAGACATATCAACC No data
Right 900941973 1:5804742-5804764 ACCTGCTCTACGTACTTGGGAGG No data
900941968_900941975 21 Left 900941968 1:5804722-5804744 CCCCAAATGTAGACATATCAACC No data
Right 900941975 1:5804766-5804788 CAAGCTACAAATGATTCCAGAGG No data
900941968_900941972 -6 Left 900941968 1:5804722-5804744 CCCCAAATGTAGACATATCAACC No data
Right 900941972 1:5804739-5804761 TCAACCTGCTCTACGTACTTGGG No data
900941968_900941971 -7 Left 900941968 1:5804722-5804744 CCCCAAATGTAGACATATCAACC No data
Right 900941971 1:5804738-5804760 ATCAACCTGCTCTACGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900941968 Original CRISPR GGTTGATATGTCTACATTTG GGG (reversed) Intergenic
No off target data available for this crispr