ID: 900941973

View in Genome Browser
Species Human (GRCh38)
Location 1:5804742-5804764
Sequence ACCTGCTCTACGTACTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900941963_900941973 28 Left 900941963 1:5804691-5804713 CCACAGCACCCCAGTCCTTGTAA No data
Right 900941973 1:5804742-5804764 ACCTGCTCTACGTACTTGGGAGG No data
900941968_900941973 -3 Left 900941968 1:5804722-5804744 CCCCAAATGTAGACATATCAACC No data
Right 900941973 1:5804742-5804764 ACCTGCTCTACGTACTTGGGAGG No data
900941966_900941973 18 Left 900941966 1:5804701-5804723 CCAGTCCTTGTAAGAGAATCACC No data
Right 900941973 1:5804742-5804764 ACCTGCTCTACGTACTTGGGAGG No data
900941964_900941973 20 Left 900941964 1:5804699-5804721 CCCCAGTCCTTGTAAGAGAATCA No data
Right 900941973 1:5804742-5804764 ACCTGCTCTACGTACTTGGGAGG No data
900941967_900941973 13 Left 900941967 1:5804706-5804728 CCTTGTAAGAGAATCACCCCAAA No data
Right 900941973 1:5804742-5804764 ACCTGCTCTACGTACTTGGGAGG No data
900941970_900941973 -5 Left 900941970 1:5804724-5804746 CCAAATGTAGACATATCAACCTG No data
Right 900941973 1:5804742-5804764 ACCTGCTCTACGTACTTGGGAGG No data
900941965_900941973 19 Left 900941965 1:5804700-5804722 CCCAGTCCTTGTAAGAGAATCAC No data
Right 900941973 1:5804742-5804764 ACCTGCTCTACGTACTTGGGAGG No data
900941962_900941973 29 Left 900941962 1:5804690-5804712 CCCACAGCACCCCAGTCCTTGTA No data
Right 900941973 1:5804742-5804764 ACCTGCTCTACGTACTTGGGAGG No data
900941969_900941973 -4 Left 900941969 1:5804723-5804745 CCCAAATGTAGACATATCAACCT No data
Right 900941973 1:5804742-5804764 ACCTGCTCTACGTACTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900941973 Original CRISPR ACCTGCTCTACGTACTTGGG AGG Intergenic
No off target data available for this crispr