ID: 900942165

View in Genome Browser
Species Human (GRCh38)
Location 1:5806602-5806624
Sequence CAGACAGTACGTAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900942161_900942165 0 Left 900942161 1:5806579-5806601 CCATGGTAACACAAAAGCAGCCA No data
Right 900942165 1:5806602-5806624 CAGACAGTACGTAAGGAAGTGGG No data
900942159_900942165 13 Left 900942159 1:5806566-5806588 CCATTCAGCTCCACCATGGTAAC No data
Right 900942165 1:5806602-5806624 CAGACAGTACGTAAGGAAGTGGG No data
900942160_900942165 3 Left 900942160 1:5806576-5806598 CCACCATGGTAACACAAAAGCAG No data
Right 900942165 1:5806602-5806624 CAGACAGTACGTAAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900942165 Original CRISPR CAGACAGTACGTAAGGAAGT GGG Intergenic
No off target data available for this crispr